View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16667_high_2 (Length: 370)

Name: NF16667_high_2
Description: NF16667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16667_high_2
NF16667_high_2
[»] chr2 (1 HSPs)
chr2 (164-254)||(6706825-6706915)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 164 - 254
Target Start/End: Original strand, 6706825 - 6706915
Alignment:
Q  164 agagaactaagaatcagaacaaaaatcaagagaactaaaacgaaaagtaagaatttttataggataagaaaaatatttaagcctaaataga 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  6706825 agagaactaagaatcagaacaaaaatcaagagaactaaaacgaaaagtaagaatttttatagggtaagaaaaatatttaagcctaaataga 6706915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University