View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16666_high_26 (Length: 206)

Name: NF16666_high_26
Description: NF16666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16666_high_26
NF16666_high_26
[»] chr4 (3 HSPs)
chr4 (127-191)||(38195761-38195825)
chr4 (1-58)||(38195534-38195591)
chr4 (67-97)||(38195583-38195613)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 127 - 191
Target Start/End: Original strand, 38195761 - 38195825
Alignment:
Q  127 gaaagaattatacgctcatcttgaaaacaggaagaattttatgcgaaaatgtaaatttggagaat 191  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  38195761 gaaagaattatacgctcatcttgaaaacaagaagaattttatgcgaaaatgtaaatttggagaat 38195825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 38195534 - 38195591
Alignment:
Q  1 tagttttatatttagtcactataaaagtaaaataagattaaacttagactaaacttaa 58  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  38195534 tagttttatatttagtcactataaaagcaaaataagattaaacttagactaaacttaa 38195591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 97
Target Start/End: Original strand, 38195583 - 38195613
Alignment:
Q  67 taaacttaaaagtagtgaacttcatagggaa 97  Q
    |||||||||||||||||||||||||||||||    
T  38195583 taaacttaaaagtagtgaacttcatagggaa 38195613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University