View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16661_high_57 (Length: 227)

Name: NF16661_high_57
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16661_high_57
NF16661_high_57
[»] chr7 (2 HSPs)
chr7 (140-175)||(40960737-40960772)
chr7 (101-131)||(40960691-40960721)
[»] chr3 (1 HSPs)
chr3 (57-86)||(37972407-37972436)


Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 175
Target Start/End: Original strand, 40960737 - 40960772
Alignment:
Q  140 aattatgaacattgcgcatcggcttttgtctaccgc 175  Q
    ||||||||||||||||||||||||||||||||||||    
T  40960737 aattatgaacattgcgcatcggcttttgtctaccgc 40960772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 131
Target Start/End: Original strand, 40960691 - 40960721
Alignment:
Q  101 aaatgaagttgattgaggtcaatttatatag 131  Q
    |||||||||||||||||||||||||||||||    
T  40960691 aaatgaagttgattgaggtcaatttatatag 40960721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 86
Target Start/End: Complemental strand, 37972436 - 37972407
Alignment:
Q  57 cctaaccgctagaccatgggaccgattgtt 86  Q
    ||||||||||||||||||||||||||||||    
T  37972436 cctaaccgctagaccatgggaccgattgtt 37972407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University