View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16659_low_15 (Length: 274)

Name: NF16659_low_15
Description: NF16659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16659_low_15
NF16659_low_15
[»] chr3 (1 HSPs)
chr3 (15-217)||(26538982-26539187)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 26539187 - 26538982
Alignment:
Q  15 acttcactctgccgtaaattttaaatttccttttca-ttttattgattgaatactct--gtcattctctaactctaattgcaacaagaaaattgttcttt 111  Q
    ||||||||||||||||||||||||||||   ||| | ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
T  26539187 acttcactctgccgtaaattttaaattttgatttaaattttattgattgaatactctctgtcattctctaactctaattgcaacaagaaaattgttcttt 26539088  T
Q  112 tactttagtaatcaaattcactggataatcccatctttgtatttactgcaaagagaccctctcagctgttttttattataaaatagtttagatgagttgg 211  Q
    ||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
T  26539087 taccttaataatcaaattcattggataatcccatctttgtatttactgcaaagagaccctctcagccattttttattataaaatagtttagatgagttgg 26538988  T
Q  212 tctaaa 217  Q
    ||||||    
T  26538987 tctaaa 26538982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University