View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16656_low_14 (Length: 281)

Name: NF16656_low_14
Description: NF16656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16656_low_14
NF16656_low_14
[»] chr1 (1 HSPs)
chr1 (110-255)||(12433926-12434066)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 110 - 255
Target Start/End: Original strand, 12433926 - 12434066
Alignment:
Q  110 ggttgcatgaaaagggttttgctaattttattatattttttcactc--acttataaaacctgacaccccttttcataaagttcggattttttgtatgatt 207  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  12433926 ggttgcatgaacagggttttgctaattttattatattttttcactctcacttataaaacctgacaccccttttcataaagtttggattttttgtatgatt 12434025  T
Q  208 ttgatcacagtttggattttggattttccgttaagattcttgataaag 255  Q
    ||||||||||       |||||||||||||||||||||||||||||||    
T  12434026 ttgatcacag-------tttggattttccgttaagattcttgataaag 12434066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University