View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16647_low_22 (Length: 249)

Name: NF16647_low_22
Description: NF16647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16647_low_22
NF16647_low_22
[»] chr2 (3 HSPs)
chr2 (49-142)||(34982531-34982624)
chr2 (153-239)||(34982723-34982811)
chr2 (16-54)||(34981952-34981990)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 49 - 142
Target Start/End: Original strand, 34982531 - 34982624
Alignment:
Q  49 tgaaattttaatcaacatcattttggggtgatgcttggttagatagtggtgttttgcggtctagattcaactttcaggtgaggcacttaagctt 142  Q
    |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  34982531 tgaaattttaatcaacatcattttggtgtgatgtttggttagatagtggtgttttgcggtctagattcaattttcaggtgaggcacttaagctt 34982624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 153 - 239
Target Start/End: Original strand, 34982723 - 34982811
Alignment:
Q  153 caggttaatagaatagacaaatgaatctggcaacata--accccaatgagggatactttgtaaaagggcttatcgtattctcatgccta 239  Q
    |||||||||||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||    
T  34982723 caggttaatagaatagacaaatgaatctggcaacatataaccccaatgaaggatactttgtaaaagggcttatcgtattctcatgccta 34982811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 34981952 - 34981990
Alignment:
Q  16 gtatatatgtctagaatgataacagaagttatctgaaat 54  Q
    |||||||||| ||||||||||||||||||||||||||||    
T  34981952 gtatatatgtgtagaatgataacagaagttatctgaaat 34981990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University