View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16642_low_31 (Length: 215)

Name: NF16642_low_31
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16642_low_31
NF16642_low_31
[»] chr4 (1 HSPs)
chr4 (19-215)||(31975121-31975319)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 31975319 - 31975121
Alignment:
Q  19 tctcgtcaagaagcgatgagaagtttgtgcggagacaaataaatgaggttgttcataaaccattctaaatctattttttct--cattattatagaaactc 116  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |  |||||||||||||||||    
T  31975319 tctcgtcaagaagcgatgagaagtttgtgcagagacaaataaatgaggttgctcataaaccattctaaatctattttttttatcattattatagaaactc 31975220  T
Q  117 taatacgaagtatatgctgagacaaacaaatgagattgtttataatttatccaagacggttatatttaccgctagttttcagatgttggttgagatact 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||||    
T  31975219 taatacgaagtatatgctgagacaaacaaatgagattgtttataatttatccaagacggccacatttaccgctagttttcagatgttggttgagatact 31975121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University