View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16636_low_16 (Length: 238)

Name: NF16636_low_16
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16636_low_16
NF16636_low_16
[»] chr2 (1 HSPs)
chr2 (44-176)||(25551403-25551535)


Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 44 - 176
Target Start/End: Complemental strand, 25551535 - 25551403
Alignment:
Q  44 ttattctacggggtgggaacggatattatattacccgttttgaggacgtggatactaagagtgttcatcattaagaataaaagtgtctaatgcctcatat 143  Q
    ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25551535 ttattctacggggtgggaatggatattatactacccgttttgaggacgtggatactaagagtgttcatcattaagaataaaagtgtctaatgcctcatat 25551436  T
Q  144 atgataacattaaagtaggacacaaacactacc 176  Q
    |||||||||||||||||||||||||||||||||    
T  25551435 atgataacattaaagtaggacacaaacactacc 25551403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University