View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16633_low_6 (Length: 309)

Name: NF16633_low_6
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16633_low_6
NF16633_low_6
[»] chr4 (2 HSPs)
chr4 (167-292)||(7474663-7474788)
chr4 (14-81)||(7474874-7474941)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 167 - 292
Target Start/End: Complemental strand, 7474788 - 7474663
Alignment:
Q  167 ttgaaggaatgaattacctaattggtggtggcggaggtttgtttttgagcgtaattaggaggagagtagacgagagcagccaccatagcagctggaagca 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7474788 ttgaaggaatgaattacctaattggtggtggcggaggtttgtttttgagcgtaattaggaggagagtagacgagagcagccaccatagcagctggaagca 7474689  T
Q  267 caccgaatctcgccaacgctgccact 292  Q
    ||||||||||||||||||||||||||    
T  7474688 caccgaatctcgccaacgctgccact 7474663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 7474941 - 7474874
Alignment:
Q  14 aatactaaatggcctttagcaaagttttaatcagtaataatttcataacctaaattaattattcactc 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7474941 aatactaaatggcctttagcaaagttttaatcagtaataatttcataacctaaattaattattcactc 7474874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University