View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16632_high_86 (Length: 218)

Name: NF16632_high_86
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16632_high_86
NF16632_high_86
[»] chr4 (1 HSPs)
chr4 (17-203)||(52066670-52066863)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 52066863 - 52066670
Alignment:
Q  17 acagatgctattaccatacggactgatagaaacttgcactcaactagaacttcactagttagctaatcccttggcttcattacttttataattcttcaat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  52066863 acagatgctattaccatacggactgatagaaacttgcactcaactagaacttcactagttagctattcccttggcttcattacttttataattcttcaat 52066764  T
Q  117 aaataagggattaatgaaggaaaatgctaacatgtgtcctaaaggcattagaac-------aacaaactacttatagtaattttgtttcaaaat 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||    
T  52066763 aaataagggattaatgaaggaaaatgctaacatgtgtcctaaaggcattagaacacgtgttaacaaactacttatagtaattttgtttcaaaat 52066670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University