View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16632_high_82 (Length: 233)

Name: NF16632_high_82
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16632_high_82
NF16632_high_82
[»] chr4 (1 HSPs)
chr4 (53-118)||(5276962-5277027)
[»] chr6 (1 HSPs)
chr6 (174-225)||(12288840-12288891)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 53 - 118
Target Start/End: Original strand, 5276962 - 5277027
Alignment:
Q  53 ttttctgagttggaaacaaaactccctagttcagtgttcgtttcacatatctcattttctccttgt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  5276962 ttttctgagttggaaacaaaactccctagttcagtgttcgtttcacatatttcattttctccttgt 5277027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 12288891 - 12288840
Alignment:
Q  174 agtgaacctacgatgcctttatgcattgtagcattcacttatttttcatttc 225  Q
    ||||||||||| || ||| ||| ||||||||||||||||| |||||||||||    
T  12288891 agtgaacctacaattcctctatacattgtagcattcacttctttttcatttc 12288840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University