View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16630_low_41 (Length: 246)

Name: NF16630_low_41
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16630_low_41
NF16630_low_41
[»] chr2 (1 HSPs)
chr2 (18-229)||(17776069-17776280)
[»] chr8 (1 HSPs)
chr8 (148-200)||(41050000-41050052)
[»] chr4 (1 HSPs)
chr4 (139-167)||(21496432-21496460)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 17776280 - 17776069
Alignment:
Q  18 atttcttgctgccatttgtaagcaggtaaggaacaaacaataagcgagtaaatagtcaagttggtccttaaaactgtacggttgtattaacctagtctcc 117  Q
    |||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17776280 atttcttgctgcaatatgcaagcaggtaaggaacaaacaataagcgagtaaatagtcaagttggtccttaaaactgtacggttgtattaacctagtctcc 17776181  T
Q  118 cacattatcgactttctaaattgatccctgaaattgcaaaatgttaatcaattttatccctttatctagatctgttatcaaatgcattcttgacactatg 217  Q
    ||  ||||||||||||||||||| |||| |||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||    
T  17776180 catgttatcgactttctaaattgttccccgaaattgcaaaatgttaatcaaatttgtccctttatctatatctgttatcaaatgcattcttgacactatg 17776081  T
Q  218 cactcagtttca 229  Q
    ||||||||||||    
T  17776080 cactcagtttca 17776069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 41050052 - 41050000
Alignment:
Q  148 aaattgcaaaatgttaatcaattttatccctttatctagatctgttatcaaat 200  Q
    ||||||||||||| ||||||| || |||| | |||||||| ||||||||||||    
T  41050052 aaattgcaaaatggtaatcaacttcatccatctatctagagctgttatcaaat 41050000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 167
Target Start/End: Original strand, 21496432 - 21496460
Alignment:
Q  139 tgatccctgaaattgcaaaatgttaatca 167  Q
    |||||||||||||||||||||||||||||    
T  21496432 tgatccctgaaattgcaaaatgttaatca 21496460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University