View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16630_low_37 (Length: 256)

Name: NF16630_low_37
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16630_low_37
NF16630_low_37
[»] chr4 (1 HSPs)
chr4 (92-250)||(25619615-25619773)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 92 - 250
Target Start/End: Original strand, 25619615 - 25619773
Alignment:
Q  92 aatattgagagagtgatggtgaactagatctgaaagttcaagtaactatagctcaaaggtttcatctttcaatcaaagggtcattcatcaaatgctttaa 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25619615 aatattgagagagtgatggtgaactagatctgaaagttcaagtaactatagctcaaaggtttcatctttcaatcaaagggtcattcatcaaatgctttaa 25619714  T
Q  192 ggctttggttttggttttgattttctcagtgtcagaaaatgccttctccttcatctcac 250  Q
    ||||||||||||||||||||||||||  |||||||||||||||||||||||||| ||||    
T  25619715 ggctttggttttggttttgattttctgggtgtcagaaaatgccttctccttcatttcac 25619773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University