View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16629_low_73 (Length: 211)

Name: NF16629_low_73
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16629_low_73
NF16629_low_73
[»] chr7 (1 HSPs)
chr7 (171-211)||(22250935-22250975)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 22250935 - 22250975
Alignment:
Q  171 acaagcagcactgaaatttttgatgataaaacctcacatgc 211  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  22250935 acaagcagcactgaaatttttgatgataaaacctcacatgc 22250975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University