View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16626_high_29 (Length: 222)

Name: NF16626_high_29
Description: NF16626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16626_high_29
NF16626_high_29
[»] chr2 (1 HSPs)
chr2 (16-208)||(16461658-16461863)
[»] chr3 (2 HSPs)
chr3 (56-103)||(23607926-23607973)
chr3 (58-116)||(1916765-1916825)
[»] chr8 (1 HSPs)
chr8 (67-103)||(2648544-2648580)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 16461658 - 16461863
Alignment:
Q  16 acacaaacactagacgcgacacttacacgttgacgccagtaataatttaataaaatggcaaaatttaatgtaatcatgtgtgttggt------------- 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||                 
T  16461658 acacaaacactagacgcgacacttacacgttgacgccagtaataatttaataaaatggcaaaatttaatgtaatcacgtgtgttggtggtgtcagtgtcg 16461757  T
Q  103 ggtgttagtgtcggacacgtggcacgcctacgacaaatgaggctgcattgagtgcttttgaccacgttcctctttaatatcaaatatcacaaactgcaac 202  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16461758 ggtgtcagtgtcggacacgtggcacgcctatgacgaatgaggctgcattgagtgcttttgaccacgttcctctttaatatcaaatatcacaaactgcaac 16461857  T
Q  203 ctttgc 208  Q
    | ||||    
T  16461858 cgttgc 16461863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 103
Target Start/End: Original strand, 23607926 - 23607973
Alignment:
Q  56 aataatttaataaaatggcaaaatttaatgtaatcatgtgtgttggtg 103  Q
    ||||||||||||||||| ||||||| |||||||| |||||||| ||||    
T  23607926 aataatttaataaaatgacaaaattgaatgtaataatgtgtgtcggtg 23607973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 116
Target Start/End: Original strand, 1916765 - 1916825
Alignment:
Q  58 taatttaataaaatggcaaaatttaatgtaatcatgtgtgttggtg--gtgttagtgtcgg 116  Q
    |||||||| ||| || ||||||||||||||||||  ||||||||||  |||||||||||||    
T  1916765 taatttaagaaattgacaaaatttaatgtaatcacatgtgttggtgtcgtgttagtgtcgg 1916825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 103
Target Start/End: Complemental strand, 2648580 - 2648544
Alignment:
Q  67 aaaatggcaaaatttaatgtaatcatgtgtgttggtg 103  Q
    |||||| ||||||||||||||||||| ||||||||||    
T  2648580 aaaatgacaaaatttaatgtaatcatatgtgttggtg 2648544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University