View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16618_low_47 (Length: 210)

Name: NF16618_low_47
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16618_low_47
NF16618_low_47
[»] chr4 (1 HSPs)
chr4 (20-200)||(56278993-56279171)
[»] chr1 (1 HSPs)
chr1 (55-91)||(46571673-46571709)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 56278993 - 56279171
Alignment:
Q  20 tcacccaacataactactgaactgatcataactctgccataatgcaaaatgattcagcagtataattggcacatccatcttattgaatccaagaccagca 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56278993 tcacccaacataactactgaactgatcataactctgccataatgcaaaatgattcagcagtataattggcacatccatcttattgaatccaagaccagca 56279092  T
Q  120 cataataattttatgcgcatcccttcaacatacataaatcagttgtac--ttggtttctattatctatgctgtctctgctcct 200  Q
    |||||||||||||||||||||||||||    |||||||||||||||||  ||||||||||||||||||||||| |||| ||||    
T  56279093 cataataattttatgcgcatcccttca----acataaatcagttgtacaattggtttctattatctatgctgtgtctggtcct 56279171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 46571673 - 46571709
Alignment:
Q  55 gccataatgcaaaatgattcagcagtataattggcac 91  Q
    |||||||||||||||||||||||| ||||||||||||    
T  46571673 gccataatgcaaaatgattcagcactataattggcac 46571709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University