View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16613_low_4 (Length: 258)

Name: NF16613_low_4
Description: NF16613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16613_low_4
NF16613_low_4
[»] chr5 (1 HSPs)
chr5 (9-244)||(38898967-38899202)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 38898967 - 38899202
Alignment:
Q  9 gagatgaactatggactgaagtaattgtgaggaactagagatggctctagctatgaagggtnnnnnnngtccatgttgagatgcaaaagctatcttacaa 108  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
T  38898967 gagatgaactgtggactgaagtaattgtgaggaactagagatggctctagctatgaagggtaaaaaaagtccatgttgagatgcaaaagctatcttacaa 38899066  T
Q  109 acccagtttactacaatggttgcatatatgcagagtcatttggaagnnnnnnnagtagtaatctagaaacatggttgccaaggacttaaaataaaccaca 208  Q
    |||||||||||||||||||||||||||||||||||||||| |||||       |||||||||||||||||||||||||||||||||||||||||||||||    
T  38899067 acccagtttactacaatggttgcatatatgcagagtcattgggaagtttttttagtagtaatctagaaacatggttgccaaggacttaaaataaaccaca 38899166  T
Q  209 tacttgttctcatgccaacacttccaccaactagat 244  Q
    ||||||||||||||||||||||||||||||||||||    
T  38899167 tacttgttctcatgccaacacttccaccaactagat 38899202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University