View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16612_low_26 (Length: 233)

Name: NF16612_low_26
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16612_low_26
NF16612_low_26
[»] chr8 (1 HSPs)
chr8 (113-217)||(44855095-44855199)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 113 - 217
Target Start/End: Original strand, 44855095 - 44855199
Alignment:
Q  113 ttaatatattccatgtattgaacattttggcaccaacaaacgttttctcttgttttttattatttacaaaaatgtggtttgttttcaatttaataaaatc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44855095 ttaatatattccatgtattgaacattttggcaccaacaaacgttttctcttgttttttattatttacaaaaatgtggtttgttttcaatttaataaaatc 44855194  T
Q  213 atatt 217  Q
    |||||    
T  44855195 atatt 44855199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University