View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16604_low_37 (Length: 228)

Name: NF16604_low_37
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16604_low_37
NF16604_low_37
[»] chr3 (1 HSPs)
chr3 (19-216)||(3458908-3459103)
[»] chr1 (1 HSPs)
chr1 (101-174)||(44674743-44674816)
[»] chr4 (1 HSPs)
chr4 (116-174)||(25130818-25130876)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 3458908 - 3459103
Alignment:
Q  19 tttacagccatccattgatcctagagtggaggtgtcatctctttggaacaaggacgtccctttaaagatagttccgtgtgtgtggcgtctgttttgtgat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||   ||||||||||||||||||| ||||    
T  3458908 tttacagccatccattgatcctagagtggaggtgtcatctcttcggaacaaggacgtccctttaaagatagtta--tgtgtgtggcgtctgttttatgat 3459005  T
Q  119 aggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccgtttgtgtctcagtgggtgtggatttatggaaacttcatctca 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  3459006 aggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccgtttgtgtgtcagtgggtgtggatttatggaaacttcatctca 3459103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 44674743 - 44674816
Alignment:
Q  101 tggcgtctgttttgtgataggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccg 174  Q
    |||| ||||||| | |||||| ||||| |||| |||||||||||||| || |||||||||| ||| ||||||||    
T  44674743 tggcatctgtttcgagataggttgcctacaaaggataatcttcttcgtcgtggagttattggtaacgattcccg 44674816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 174
Target Start/End: Complemental strand, 25130876 - 25130818
Alignment:
Q  116 gataggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccg 174  Q
    |||||||||||| |||| ||||| |||||||| || ||||||||| ||| |||||||||    
T  25130876 gataggctgcctacaaaggataaccttcttcgtcgtggagttattaatattgattcccg 25130818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University