View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16592_low_121 (Length: 202)

Name: NF16592_low_121
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16592_low_121
NF16592_low_121
[»] chr4 (1 HSPs)
chr4 (107-184)||(35340852-35340928)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 107 - 184
Target Start/End: Original strand, 35340852 - 35340928
Alignment:
Q  107 agaggtggcaattggcattacaagagtgagttttttggtacaaaatgaaggctgggggcgtgttaaaagagaagtatt 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||    
T  35340852 agaggtggcaattggcattacaagagtgagttttttggtacaaaatgaaggct-ggggtgtgtcaaaagagaagtatt 35340928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University