View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16592_high_87 (Length: 256)

Name: NF16592_high_87
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16592_high_87
NF16592_high_87
[»] chr4 (1 HSPs)
chr4 (148-238)||(9142662-9142752)
[»] chr6 (1 HSPs)
chr6 (3-77)||(11225759-11225837)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 9142752 - 9142662
Alignment:
Q  148 gattaatgcatatactgatgatgctattggaaaactatatggtgctgagcactcgggtcgagtacgcggtttgggtttgggggtttgtcca 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9142752 gattaatgcatatactgatgatgctattggaaaactatatggtgctgagcactcgggtcgagtacgcggtttgggtttgggggtttgtcca 9142662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 3 - 77
Target Start/End: Original strand, 11225759 - 11225837
Alignment:
Q  3 atcatactttatgtcatggtttagtgacttgata------tctttctcattatacatatataaacaataatatttattcct 77  Q
    ||||||||||||||||||||||||||||||||||      |||||||||||||||  ||||||||||||||||||||||||    
T  11225759 atcatactttatgtcatggtttagtgacttgatatctttctctttctcattatac--atataaacaataatatttattcct 11225837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University