View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16592_high_113 (Length: 205)

Name: NF16592_high_113
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16592_high_113
NF16592_high_113
[»] chr7 (1 HSPs)
chr7 (90-190)||(24561433-24561533)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 90 - 190
Target Start/End: Original strand, 24561433 - 24561533
Alignment:
Q  90 ggcctcttctattgtgtccaacagttaaaaagctactgtcaactgtatcctgcaaatcagggaatatccttattgatatcagctttacaataaccccttt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24561433 ggcctcttctattgtgtccaacagttaaaaagctactgtcaactgtatcctgcaaatcagggaatatccttattgatatcagctttacaataaccccttt 24561532  T
Q  190 g 190  Q
    |    
T  24561533 g 24561533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University