View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16587_low_17 (Length: 289)

Name: NF16587_low_17
Description: NF16587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16587_low_17
NF16587_low_17
[»] chr7 (1 HSPs)
chr7 (18-279)||(31702274-31702535)


Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 31702535 - 31702274
Alignment:
Q  18 gtttcggtttgcttggtgggtttggatatggaggaggaggtgggcccttcaatcatcttaacctcgtttttggtcttggaatgggttgtggattgggtat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31702535 gtttcggtttgcttggtgggtttggatatggaggaggaggtgggcccttcaatcatcttaacctcgtttttggtcttggaatgggttgtggattgggtat 31702436  T
Q  118 tggatatggttttggtcaaggaattggttacagttttgattatcagacacgtaagtctgcaaaatctaggaagagtttttctgatactaacaaaaccatt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31702435 tggatatggttttggtcaaggaattggttacagttttgattatcagacacgtaagtctgcaaaatctaggaagagtttttctgatactaacaaaaccatt 31702336  T
Q  218 gtttttcagttatgattgtagttttttcattgtttcccaaacattgtcttattatgcctttg 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  31702335 gtttttcagttatgattgtagttttttcattgtttcccaaacattgtcttattatgcttttg 31702274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University