View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16586_low_10 (Length: 238)

Name: NF16586_low_10
Description: NF16586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16586_low_10
NF16586_low_10
[»] chr1 (1 HSPs)
chr1 (68-224)||(3245508-3245664)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 68 - 224
Target Start/End: Complemental strand, 3245664 - 3245508
Alignment:
Q  68 gatttctagaaaggttacaaggttatgtttttatgaatgattctatgaaaaaattgtggtttaaagagattctaaccttatttcatttactaatttttta 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  3245664 gatttctagaaaggttacaaggttatgtttttatgaatgattctatgaaaaaattgtggtttaaagagattctaaccttacttcatttactaatttttta 3245565  T
Q  168 ggtgcaaaaatgcatacatgataggtctatccttgttgcaacatatgatggagagca 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3245564 ggtgcaaaaatgcatacatgataggtctatccttgttgcaacatatgatggagagca 3245508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University