View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16584_low_9 (Length: 237)

Name: NF16584_low_9
Description: NF16584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16584_low_9
NF16584_low_9
[»] chr8 (1 HSPs)
chr8 (18-91)||(36342371-36342444)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 91
Target Start/End: Original strand, 36342371 - 36342444
Alignment:
Q  18 aaagccggttgtagatgacccagtttgaccccacttctcttatagcacctatcttttagttctactttgtattg 91  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  36342371 aaagccggttgtagatgacccagtttcaccccacttctcttatagcacctatcttttagttctactttgtattg 36342444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University