View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16584_low_4 (Length: 307)

Name: NF16584_low_4
Description: NF16584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16584_low_4
NF16584_low_4
[»] chr4 (2 HSPs)
chr4 (1-142)||(20518738-20518881)
chr4 (182-279)||(20518922-20519015)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 20518738 - 20518881
Alignment:
Q  1 aggtccaaaaagggttaaagaaaggtc--atccacgtgaaatagtataatgaaaacgtgtgtaactaaacagtgacaactaataaacaattgcatgtacg 98  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  20518738 aggtccaaaaagggttaaagaaaggtctcatccacgtgaaatagtataatgaaaacgtgtgcaactaaacagtgacaactaataaacaattgcatgtacg 20518837  T
Q  99 ttgcaaaacaagtgtcatcatagattcatacttgaataatcatg 142  Q
    ||||||||||||||||||||||||||||||||| || |||||||    
T  20518838 ttgcaaaacaagtgtcatcatagattcatacttaaaaaatcatg 20518881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 182 - 279
Target Start/End: Original strand, 20518922 - 20519015
Alignment:
Q  182 tttggtttcatccacctacaaatatttagattttagcagcagtaacaaacaaacaaacatagtactatgttatgttgtcggtgaaatattgaaaatgg 279  Q
    ||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20518922 tttggtttcatccacctacaaatatttagattttagcagcag----caacaaacaaacatagtactatgttatgttgtcggtgaaatattgaaaatgg 20519015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University