View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16583_low_29 (Length: 224)

Name: NF16583_low_29
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16583_low_29
NF16583_low_29
[»] chr2 (2 HSPs)
chr2 (40-93)||(24182868-24182921)
chr2 (150-204)||(24182969-24183023)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 40 - 93
Target Start/End: Original strand, 24182868 - 24182921
Alignment:
Q  40 aaatcttgtgatgaagcctctacgaatttgaagacttccagaagaagattatgt 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24182868 aaatcttgtgatgaagcctctacgaatttgaagacttccagaagaagattatgt 24182921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 24182969 - 24183023
Alignment:
Q  150 gggatcagtgtccacgacactgaaactttacgatgatccttggaagatcaagaag 204  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  24182969 gggatcagtgtccacgacattgaaactttacgatgatccttggaagatcaagaag 24183023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University