View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16573_low_32 (Length: 331)

Name: NF16573_low_32
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16573_low_32
NF16573_low_32
[»] chr5 (2 HSPs)
chr5 (1-198)||(2177229-2177426)
chr5 (255-318)||(2177110-2177173)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 2177426 - 2177229
Alignment:
Q  1 catagcaaagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
T  2177426 catagcaaagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagaaaaaaattcaggtaattagtccatgaccctttg 2177327  T
Q  101 tgccccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccata 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2177326 tgccccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccata 2177229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 255 - 318
Target Start/End: Complemental strand, 2177173 - 2177110
Alignment:
Q  255 aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatat 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2177173 aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatat 2177110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University