View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16573_high_51 (Length: 216)

Name: NF16573_high_51
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16573_high_51
NF16573_high_51
[»] chr1 (4 HSPs)
chr1 (40-132)||(47920030-47920122)
chr1 (45-119)||(47911205-47911279)
chr1 (48-97)||(47925288-47925337)
chr1 (54-119)||(47904146-47904211)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 40 - 132
Target Start/End: Complemental strand, 47920122 - 47920030
Alignment:
Q  40 tgagccatggcactgcagagtagcttctccatacatgatggaaaatacgatgatgatggtctcataaaacgaacaggttttcatcttgacatg 132  Q
    |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  47920122 tgagccatggcactgcagagtagcttctccatacatgatgaaaaatatgatgatgatggtctcataaaacgaacaggttttcatcttgacatg 47920030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 119
Target Start/End: Complemental strand, 47911279 - 47911205
Alignment:
Q  45 catggcactgcagagtagcttctccatacatgatggaaaatacgatgatgatggtctcataaaacgaacaggttt 119  Q
    ||||||| ||||||||||||| |||||  ||  || |||||| ||||||||||||| ||||||||||||||||||    
T  47911279 catggcagtgcagagtagcttatccattgatagtgtaaaatatgatgatgatggtcacataaaacgaacaggttt 47911205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 97
Target Start/End: Complemental strand, 47925337 - 47925288
Alignment:
Q  48 ggcactgcagagtagcttctccatacatgatggaaaatacgatgatgatg 97  Q
    ||||||||||||||||||||||||  ||||||||| ||||||||||||||    
T  47925337 ggcactgcagagtagcttctccatggatgatggaagatacgatgatgatg 47925288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 54 - 119
Target Start/End: Complemental strand, 47904211 - 47904146
Alignment:
Q  54 gcagagtagcttctccatacatgatggaaaatacgatgatgatggtctcataaaacgaacaggttt 119  Q
    ||||||||| || |||||| | |||||||| || ||||||||||||| ||| ||||||||||||||    
T  47904211 gcagagtagtttttccatagaagatggaaagtatgatgatgatggtcgcatgaaacgaacaggttt 47904146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University