View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16572_high_28 (Length: 246)

Name: NF16572_high_28
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16572_high_28
NF16572_high_28
[»] chr8 (1 HSPs)
chr8 (1-230)||(9462419-9462648)
[»] chr6 (1 HSPs)
chr6 (33-66)||(10335771-10335804)
[»] chr2 (1 HSPs)
chr2 (33-66)||(33523453-33523486)


Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 9462648 - 9462419
Alignment:
Q  1 aattacattcattaacttccatttttacaatggtgtcaatgtcgtgtctgtgtcagtgtttcatagtttgatcagtgatgagacttttgtagatatgata 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  9462648 aattacgttcattaacttccatttttacaatggtgtcaatgtcgtgtctgtgtcagtgtttcatagtttgattagtgatgagacttttgtagatatgata 9462549  T
Q  101 gtgttgaatgttgaatttgaactatgccattaattaattatttgcttgaaattaattggttaggtttaactgatttgtaatgttgtagctgatgaagaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9462548 gtgttgaatgttgaatttgaactatgccattaattaattatttgcttgaaattaattggttaggtttaactgatttgtaatgttgtagctgatgaagaag 9462449  T
Q  201 atgctaaagaggaaaattcatccagatatt 230  Q
    ||||||||||||||||||||||||||||||    
T  9462448 atgctaaagaggaaaattcatccagatatt 9462419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 10335771 - 10335804
Alignment:
Q  33 gtgtcaatgtcgtgtctgtgtcagtgtttcatag 66  Q
    |||||| |||||||||||||||||||||||||||    
T  10335771 gtgtcactgtcgtgtctgtgtcagtgtttcatag 10335804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 33523453 - 33523486
Alignment:
Q  33 gtgtcaatgtcgtgtctgtgtcagtgtttcatag 66  Q
    ||||||||||||||||||||||||||||| ||||    
T  33523453 gtgtcaatgtcgtgtctgtgtcagtgttttatag 33523486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University