View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16572_high_25 (Length: 251)

Name: NF16572_high_25
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16572_high_25
NF16572_high_25
[»] chr4 (1 HSPs)
chr4 (1-168)||(16158652-16158819)
[»] chr1 (1 HSPs)
chr1 (57-120)||(17491299-17491362)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 16158652 - 16158819
Alignment:
Q  1 ttgaatgaaattaaattgttgatggttgttaatctcttgactagatgttgttggcttgatgactggtatatcaaatgagagggagtatattagagatggc 100  Q
    |||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  16158652 ttgaatgaaattaaattgctgatggttggtaatctgttgactagatgttgttggcttaatgactggtatatcaaatgagagggagtatattagagatggc 16158751  T
Q  101 aaggttaccaagatggttgtttttcaactaactaatgataggtaagtgcacctttcatattgtttgaa 168  Q
    ||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||    
T  16158752 aaggtgaccaagatggttgtttttcaactcactgatgataggtaagtgcacctttcatattggttgaa 16158819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 120
Target Start/End: Complemental strand, 17491362 - 17491299
Alignment:
Q  57 tgatgactggtatatcaaatgagagggagtatattagagatggcaaggttaccaagatggttgt 120  Q
    ||||||||||||||||   |||||||||||||||||| ||||| ||||| || |||||| ||||    
T  17491362 tgatgactggtatatccgctgagagggagtatattagggatgggaaggtgacaaagatgattgt 17491299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University