View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16570_high_7 (Length: 238)

Name: NF16570_high_7
Description: NF16570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16570_high_7
NF16570_high_7
[»] chr6 (1 HSPs)
chr6 (1-221)||(3820255-3820475)


Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3820475 - 3820255
Alignment:
Q  1 tttcatgtgacaatcaccccctaccactaataccaatctcaaacctaatggttttgaattaaccatgtgttcctaaaatgcagcttagaaacgtcgaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3820475 tttcatgtgacaatcaccccctaccactaataccaatctcaaacctaatggttttgaattaaccatgtgttcctaaaatgcagcttagaaacgtcgaaaa 3820376  T
Q  101 agatgttgcaaagaaatgtctgaatggtagggcttgtgtccttgctctccccatgtgaaaaagtaccaaagaattgtctcatctgaccctacattatgct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3820375 agatgttgcaaagaaatgtctgaatggtagggcttgtgtccttgctctccccatgtgaaaaagtaccaaagaattgtctcatctgaccctacattatgct 3820276  T
Q  201 aaaaatttgcgaacttcatgt 221  Q
    |||||||||||||||||||||    
T  3820275 aaaaatttgcgaacttcatgt 3820255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University