View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_57 (Length: 336)

Name: NF16569_low_57
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_57
NF16569_low_57
[»] chr6 (2 HSPs)
chr6 (4-108)||(2928489-2928593)
chr6 (50-106)||(3002717-3002773)
[»] chr8 (1 HSPs)
chr8 (43-83)||(37200252-37200292)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 4 - 108
Target Start/End: Original strand, 2928489 - 2928593
Alignment:
Q  4 caactagtctgtcaatctctggtgtactgtttcgacagtttttcagtttcttagatttgtgtattggagctgttctattgcgtttttcatagtataagtt 103  Q
    |||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||| |||||||||  ||||||| |||||| |||     
T  2928489 caactagtctgtcaatctctggtgtactgtttgggcggtttttcagtttcttagatttgtgtattggagttgttctattttgtttttcttagtatcagtc 2928588  T
Q  104 agttg 108  Q
    |||||    
T  2928589 agttg 2928593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 50 - 106
Target Start/End: Complemental strand, 3002773 - 3002717
Alignment:
Q  50 tttcttagatttgtgtattggagctgttctattgcgtttttcatagtataagttagt 106  Q
    ||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||    
T  3002773 tttcttatatttgtgtattggagctgttctattgcgtttttcttagtatcagttagt 3002717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 43 - 83
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
Q  43 ttttcagtttcttagatttgtgtattggagctgttctattg 83  Q
    ||||||||||||||| |||||||||||| |||| |||||||    
T  37200292 ttttcagtttcttagttttgtgtattggggctgctctattg 37200252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University