View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_135 (Length: 204)

Name: NF16569_low_135
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_135
NF16569_low_135
[»] chr7 (1 HSPs)
chr7 (1-204)||(33751166-33751369)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 33751166 - 33751369
Alignment:
Q  1 taggtgaagctagctataccaatgattgatgattgatgaatttgtttcattttttaattgtagcatctctcttttatgttttattgtggtggaagatgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33751166 taggtgaagctagctataccaatgattgatgattgatgaatttgtttcattttttaattgtagcatctctcttttatgttttattgtggtggaagatgga 33751265  T
Q  101 tgttatatctaaagatnnnnnnncttaatttagactgatttcatcaaattgatttttgtaattcttggattgatgtgaaccataggatttggtcatgatc 200  Q
    ||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  33751266 tgttatatctaaagataaaaaaacttaatttagactgatttcatcaaattgatttttgtaattcttggattgatgtgaaccaaaggatttggtcatgatc 33751365  T
Q  201 ctct 204  Q
    ||||    
T  33751366 ctct 33751369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University