View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_124 (Length: 216)

Name: NF16569_low_124
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_124
NF16569_low_124
[»] chr2 (1 HSPs)
chr2 (18-148)||(3964807-3964937)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 3964937 - 3964807
Alignment:
Q  18 ttagcaacacttagatcagcattacagttatcaacttggcaagaaggtgtcactgatcctccagcttttgaccctttcttgttgtaaagatgatcagtca 117  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3964937 ttagcagcacttagatcagcattacagttatcaacttggcaagaaggtgtcactgatcctccagcttttgaccctttcttgttgtaaagatgatcagtca 3964838  T
Q  118 ccacccttttctttttctcatcatctccata 148  Q
    ||||||||||| |||||||||||||||||||    
T  3964837 ccacccttttccttttctcatcatctccata 3964807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University