View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_110 (Length: 238)

Name: NF16569_low_110
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_110
NF16569_low_110
[»] chr8 (1 HSPs)
chr8 (89-222)||(39386159-39386291)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 89 - 222
Target Start/End: Original strand, 39386159 - 39386291
Alignment:
Q  89 taacaacgtgctagatttacaaataattgatttcatttacaaatgaagnnnnnnnntatactcaaatatttcctagttagaaattttttatttaatttat 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||| |||||||||||||||||||||||||||    
T  39386159 taacaacgtgctagatttacaaataattgatttcatttacaaatgaa-aaaaaatatatactcaaatatttcttagttagaaattttttatttaatttat 39386257  T
Q  189 tatggnnnnnnnntactttcacaagagagatatt 222  Q
    |||||        |||||||||||||||||||||    
T  39386258 tatggaaaaaaaatactttcacaagagagatatt 39386291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University