View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_108 (Length: 240)

Name: NF16569_low_108
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_108
NF16569_low_108
[»] chr2 (1 HSPs)
chr2 (18-240)||(40515442-40515661)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 40515661 - 40515442
Alignment:
Q  18 atgttaaacaacta--gtagtagtaagtaaccatagccattccttctttcactctctccaaccgaccagtttggtttaattgaatgggatggaaatgaaa 115  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40515661 atgttaaacaactatagtagtagtaagtaaccatagccattccttctttcactctctccaaccgaccagtttggtttaattgaatgggatggaaatgaaa 40515562  T
Q  116 tgaaatgaaaactaaactaactcccctcggccctctctatatctgtattctgtttggcagtatgggtatgtatggctaatatggcccctacttatctgcc 215  Q
    |||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40515561 tgaaa-----actaaactaactcccctcggccctctctatatctgtattctgtttggcagtatgggtatgtatggctaatatggcccctacttatctgcc 40515467  T
Q  216 ggacaaaaaacaaattctttaattt 240  Q
    |||||||||||||||||||||||||    
T  40515466 ggacaaaaaacaaattctttaattt 40515442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University