View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_high_92 (Length: 242)

Name: NF16569_high_92
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_high_92
NF16569_high_92
[»] chr4 (2 HSPs)
chr4 (125-220)||(9783244-9783347)
chr4 (17-45)||(9783133-9783161)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 125 - 220
Target Start/End: Original strand, 9783244 - 9783347
Alignment:
Q  125 gatggtagatacatatctaatcaaactttaaagtattatagtgttcactttt-------actcctttgtttaaacgatctttgtcattgttac-tacctc 216  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||| ||       |||||||||||||||||||||||||||||||||| ||||||    
T  9783244 gatggtagatacatatctaatcaaactttaaagtattctagtgttcactattttcctcaactcctttgtttaaacgatctttgtcattgttacttacctc 9783343  T
Q  217 attt 220  Q
    ||||    
T  9783344 attt 9783347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 9783133 - 9783161
Alignment:
Q  17 cataggcaaaatgtcatatgatgctctgt 45  Q
    |||||||||||||||||||||||||||||    
T  9783133 cataggcaaaatgtcatatgatgctctgt 9783161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University