View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16565_low_10 (Length: 366)

Name: NF16565_low_10
Description: NF16565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16565_low_10
NF16565_low_10
[»] chr5 (2 HSPs)
chr5 (119-226)||(18167843-18167950)
chr5 (1-120)||(18167987-18168101)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 18167950 - 18167843
Alignment:
Q  119 tacttgaacaatcttttgggaggaaagaaacctatgaccaataaaagaagaatgaatgatgagtacaaccatgcgcactgaaaaatatttgatcatgtca 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  18167950 tacttgaacaatcttttgggaggaaagaaacctatgaccaataaaagaagaatgaatgatgagtacaaccatgcgcactgaaaaatatttgatcatggca 18167851  T
Q  219 aactttat 226  Q
    ||||||||    
T  18167850 aactttat 18167843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 18168101 - 18167987
Alignment:
Q  1 ttataattcttaaatgttaatgccctaccaaaatttgatctggttgcgtcttataacaatgatcatgattccactttgaatcgatttttacttcaatgac 100  Q
    |||| ||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  18168101 ttatcattcttaaatgttaatgccctaccaaaatttgat-----tgcgtcttataacaatgatcatgattccactttgaatcgatttttacttcaacgac 18168007  T
Q  101 ttgttgggttaggcacatta 120  Q
    ||||||||||||||||||||    
T  18168006 ttgttgggttaggcacatta 18167987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University