View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16563_low_16 (Length: 207)

Name: NF16563_low_16
Description: NF16563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16563_low_16
NF16563_low_16
[»] chr5 (2 HSPs)
chr5 (75-126)||(508231-508282)
chr5 (15-43)||(508171-508199)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 75 - 126
Target Start/End: Original strand, 508231 - 508282
Alignment:
Q  75 catctttgatgaaaacgttttagaccttggagacaaaggtagattacatgtc 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  508231 catctttgatgaaaacgttttagaccttggagacaaaggtagattacatgtc 508282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Original strand, 508171 - 508199
Alignment:
Q  15 gaaatgaaaaacagatatggacaaatcaa 43  Q
    |||||||||||||||||||||||||||||    
T  508171 gaaatgaaaaacagatatggacaaatcaa 508199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University