View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16560_low_19 (Length: 219)

Name: NF16560_low_19
Description: NF16560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16560_low_19
NF16560_low_19
[»] chr8 (1 HSPs)
chr8 (1-194)||(33562953-33563146)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 33563146 - 33562953
Alignment:
Q  1 atttttatgggctcaacactttgggttcatttattttaggagcttctttttccacctccacgattcatacaaaccgttttcatttgaatcaaccaatttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
T  33563146 atttttatgggctcaacactttgggttcatttattttaggagcttctttttccacctccacgattcttacaaaccgttttcatttgaatctaccaatttg 33563047  T
Q  101 tatagaaaaaacactatgttttgtccagatttatttactcattcgagtgcgacacaccacttttcttcagttgaaaaagaatcaaatgagccgt 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  33563046 tatagaaaaaacactatgttttgtccagatttatttactcattcgagtgcgacacaccacttttcttcagttgaaaaagaatcaaaggagccgt 33562953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University