View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_85 (Length: 296)

Name: NF16554_low_85
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_85
NF16554_low_85
[»] chr2 (1 HSPs)
chr2 (21-280)||(2932917-2933176)
[»] chr4 (1 HSPs)
chr4 (175-264)||(6997561-6997649)
[»] chr5 (1 HSPs)
chr5 (33-118)||(17623941-17624025)


Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 21 - 280
Target Start/End: Original strand, 2932917 - 2933176
Alignment:
Q  21 atttctctctttcctttgtggtgtttaagatccttttcatgtttcctccattcttgtgtatcgtcttcttttcctttgttccatccatatgctgccacaa 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||    
T  2932917 atttctctctttcctttgtggtgtttaagatccttttcatgtttcctccattcttgtgtatcgtcttcttttcctttgttccatccatacgctgtcacaa 2933016  T
Q  121 ccttaacctttcctacatacgaggtggtttggttttacttcagaggaggttcactgctcagttatcatccaccatccccaccctcgagacaaacacttta 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||    
T  2933017 ccttaacctttcctacatacgaggtggtttggttttacttcagaggaggttcactgttcagttatcatccaccatccctaccctcgagacaaacacttta 2933116  T
Q  221 cccaccatcccttcccactcaaccgattgatcattgattcactcttttctttcaacaaat 280  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||    
T  2933117 cccaccatcccttcccactcaaccggttgatcattgattcactcttttctttcgacaaat 2933176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 175 - 264
Target Start/End: Original strand, 6997561 - 6997649
Alignment:
Q  175 tgctcagttatcatccaccatccccaccctcgagacaaacactttacccaccatcccttcccactcaaccgattgatcattgattcactc 264  Q
    ||||||||||||| |||||||||| ||||| |  |||||||||||| ||||| |||||||||| | || || ||||||||||||||||||    
T  6997561 tgctcagttatcaaccaccatccctacccttggcacaaacacttta-ccaccgtcccttcccatttaatcggttgatcattgattcactc 6997649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 118
Target Start/End: Original strand, 17623941 - 17624025
Alignment:
Q  33 cctttgtggtgtttaagatccttttcatgtttcctccattcttgtgtatcgtcttcttttcctttgttccatccatatgctgccac 118  Q
    |||||||||||||| | |||| |||| |||||||||| | | |||| ||||||||||| ||||||| ||||||||| ||| |||||    
T  17623941 cctttgtggtgtttgatatccctttcttgtttcctccct-catgtgcatcgtcttcttctcctttgatccatccatttgccgccac 17624025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University