View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_78 (Length: 317)

Name: NF16554_low_78
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_78
NF16554_low_78
[»] chr2 (2 HSPs)
chr2 (141-227)||(2361118-2361204)
chr2 (74-130)||(2361248-2361304)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 141 - 227
Target Start/End: Complemental strand, 2361204 - 2361118
Alignment:
Q  141 ctctttttccttcaatcttccactgcctttattattgctattcatggcagtacaaagttgtctcttatttttcttgagatcatgtgt 227  Q
    ||||||||||||||||||||||| |||| |||||||||||| |||||| | |  ||| |||||||||||||||||||| ||| ||||    
T  2361204 ctctttttccttcaatcttccacggcctctattattgctatccatggctgcaagaagctgtctcttatttttcttgagctcaagtgt 2361118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 74 - 130
Target Start/End: Complemental strand, 2361304 - 2361248
Alignment:
Q  74 ttattttaggtcgaacatatattttcgaagcatcaagctcttcctttcttgtcttaa 130  Q
    |||||||| | | |||| |||||||| ||||||||||||||||||||||||||||||    
T  2361304 ttattttatgactaacagatattttcaaagcatcaagctcttcctttcttgtcttaa 2361248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University