View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_122 (Length: 213)

Name: NF16554_low_122
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_122
NF16554_low_122
[»] chr5 (1 HSPs)
chr5 (81-198)||(42087926-42088043)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 81 - 198
Target Start/End: Original strand, 42087926 - 42088043
Alignment:
Q  81 ggatttgagagtggaatagagggacggcatcggtgatttcaacggtgtcgttggaggaggagatgcggccgatcaagacgccgttgacggcggatgtagg 180  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42087926 ggatttgagagtggaaaagagggacggcatcggtgatttcaacggtgtcgttggaggaggagatgcggccgatcaagacgccgttgacggcggatgtagg 42088025  T
Q  181 gtgtttgagagagtgaag 198  Q
    ||||||||||||||||||    
T  42088026 gtgtttgagagagtgaag 42088043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University