View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_116 (Length: 230)

Name: NF16554_low_116
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_116
NF16554_low_116
[»] chr2 (1 HSPs)
chr2 (24-213)||(7155999-7156188)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 7156188 - 7155999
Alignment:
Q  24 gtgttccttacatgggagatgctgacatacaagctcgtaatttttgtccatattacaaagccctttatgtttccaacgatgaccaactgttgctggggaa 123  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7156188 gtgttccttacatgggagatgctgacataccagctcgtaatttttgtccatattacaaagccctttatgtttccaacgatgaccaactgttgctggggaa 7156089  T
Q  124 cgtgcacgaattggttgtttacaattcgacagatggtacttttaaggctttgggaattcaaacgatcaacggccggttgtgtccagaagt 213  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  7156088 cgtgcacgagttggttgtttacaattcaacagatggtacttttaaggctttgggaattcaaacgatcaacggccggtggtgtccagaagt 7155999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University