View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_111 (Length: 238)

Name: NF16554_low_111
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_111
NF16554_low_111
[»] scaffold0114 (1 HSPs)
scaffold0114 (14-227)||(5773-5986)


Alignment Details
Target: scaffold0114 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 5986 - 5773
Alignment:
Q  14 aggtacgtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttca 113  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  5986 aggtacgtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttca 5887  T
Q  114 gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |     
T  5886 gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgt 5787  T
Q  214 ttaccgatgatgtc 227  Q
    ||||| ||||||||    
T  5786 ttacctatgatgtc 5773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University