View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_high_96 (Length: 246)

Name: NF16554_high_96
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_high_96
NF16554_high_96
[»] chr6 (1 HSPs)
chr6 (6-236)||(6713649-6713877)


Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 6713877 - 6713649
Alignment:
Q  6 tgttgattgtgcccctatgttttgatgattcctcgggcctttagcaggatattgagtttgttgaatctcatggttcttgattttagttgcatcgtttttg 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
T  6713877 tgttgattgtgcccctatgttttgatgattcctcgggcctttagcaggatattgagtttgttgaatc--atggttcttgattttagttgcatcgtttttg 6713780  T
Q  106 cttttccttttgacattgcattggatatatgtatctcttgtactcaatttctttctatatatatgatttgatttgccactcnnnnnnncatagacatgtg 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||| |||||||    
T  6713779 cttttccttttgacattgcattggatatatgtatctcttgtactcaatttctttctatatatatgatttgatttgccactcaaaaaaacatacacatgtg 6713680  T
Q  206 tctgggtggttttgtggctttttagcctttg 236  Q
    |||||||||||||||||||||||||||||||    
T  6713679 tctgggtggttttgtggctttttagcctttg 6713649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University