View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_high_104 (Length: 236)

Name: NF16554_high_104
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_high_104
NF16554_high_104
[»] chr1 (1 HSPs)
chr1 (146-221)||(1464854-1464929)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 146 - 221
Target Start/End: Complemental strand, 1464929 - 1464854
Alignment:
Q  146 ttcttgttagatactaatatcttatctaagcttagatgagaaagagaaaaaaccaataaaatagcttaggtctctg 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1464929 ttcttgttagatactaatatcttatctaagcttagatgagaaagagaaaaaaccaataaaatagcttaggtctctg 1464854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University