View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16551_low_74 (Length: 206)

Name: NF16551_low_74
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16551_low_74
NF16551_low_74
[»] chr5 (1 HSPs)
chr5 (11-175)||(3808805-3808964)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 11 - 175
Target Start/End: Complemental strand, 3808964 - 3808805
Alignment:
Q  11 tcgaagaatatattacaagtaagacactgacacaattcctattttatgaatatccatatcataaaataaaatatgttatgtcatgtcggtatgtttgaaa 110  Q
    ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||     |||||||||||||    
T  3808964 tcgaagactatattacaagtaagacactgacacatttcctattttatgaatatccatatgataaaataaaatatgttatgtc-----ggtatgtttgaaa 3808870  T
Q  111 ttttggaaaatcctagtaatattgaattgaaaggatcaagtactttgacaactagctaattggtg 175  Q
    |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||    
T  3808869 ttttggaaaatcctagtaatattgaattgaaaggatcaggtactttggcaactagctaattggtg 3808805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University