View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16551_low_73 (Length: 212)

Name: NF16551_low_73
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16551_low_73
NF16551_low_73
[»] chr3 (2 HSPs)
chr3 (99-194)||(34688392-34688487)
chr3 (16-105)||(34688527-34688616)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 99 - 194
Target Start/End: Complemental strand, 34688487 - 34688392
Alignment:
Q  99 attaaatgtatatgcagtggggatccgacagtatatgaaagattttggagacaaacaggtgacaagagcacgatcataataccaggatggcaatcc 194  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34688487 attatatgtatatgcagtggggatccgacagtatatgaaagattttggagacaaacaggtgacaagagcacgatcataataccaggatggcaatcc 34688392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 16 - 105
Target Start/End: Complemental strand, 34688616 - 34688527
Alignment:
Q  16 atgaactagtaaataaaaagcttgtttggtatggaacataataatgatctattttttaaattgtggtcaattgacttcaatcaattaaat 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  34688616 atgaactagtaaataaaaagcttgtttggtatggaacataataatgatctattttttaaattgtggtcaattgacttgaatcaattaaat 34688527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University